FASTA format

BlastAlign: a program that uses blast to align nucleotide sequences that have large indels (INsertions/DELetions) or are otherwise difficult to align

You need to have your sequences in the following format.

>name of the first sequence
ataaattcttattttgacactcaccaaaatagtcacctggaaaacccgctttttgtgacaataaattcttattttgacactcaccaaaatagtcacctggaaaacccgctttttgtgaca
>name of the second sequence
gtaaattcttattttgacattcaccaaaatggtcacctggaaaacccgctattgtgacatgtaaattcttattttgacattcaccaaaatggtcacctggaaaacccgctattgtgacat

This web interface should cope with most variants of the above format, e.g. additional line breaks, upper case nucleotides, etc. For a full definition of FASTA format go to wikipedia

---

Developed by Robert Belshaw and Aris Katzourakis

Web-interface developed by Aris Katzourakis, Robert Belshaw and Tulio de Oliveira.