FASTA format
BlastAlign: a program that uses blast to align nucleotide sequences that have large indels (INsertions/DELetions) or are otherwise difficult to align
You need to have your sequences in the following format.
>name of the first sequence
ataaattcttattttgacactcaccaaaatagtcacctggaaaacccgctttttgtgacaataaattcttattttgacactcaccaaaatagtcacctggaaaacccgctttttgtgaca
>name of the second sequence
gtaaattcttattttgacattcaccaaaatggtcacctggaaaacccgctattgtgacatgtaaattcttattttgacattcaccaaaatggtcacctggaaaacccgctattgtgacat
This web interface should cope with most variants of the above format, e.g. additional line breaks, upper case nucleotides, etc. For a full definition of FASTA format go to
wikipedia
Developed by
Robert Belshaw
and
Aris Katzourakis
The tools development are being carried out by members of the
Evolutionary Biology Group
headed by Paul Harvey in the
Department of Zoology
at the
University of Oxford.