FASTA format

BlastAlign: a program that uses blast to align nucleotide sequences that have large indels (INsertions/DELetions) or are otherwise difficult to align


You need to have your sequences in the following format.

>name of the first sequence
ataaattcttattttgacactcaccaaaatagtcacctggaaaacccgctttttgtgacaataaattcttattttgacactcaccaaaatagtcacctggaaaacccgctttttgtgaca
>name of the second sequence
gtaaattcttattttgacattcaccaaaatggtcacctggaaaacccgctattgtgacatgtaaattcttattttgacattcaccaaaatggtcacctggaaaacccgctattgtgacat

This web interface should cope with most variants of the above format, e.g. additional line breaks, upper case nucleotides, etc. For a full definition of FASTA format go to wikipedia




Developed by Robert Belshaw and Aris Katzourakis

The tools development are being carried out by members of the Evolutionary Biology Group headed by Paul Harvey in the Department of Zoology at the University of Oxford.